Plko 1 puro map

  • vassalism
  • Friday, August 4, 2023 12:24:07 PM
  • 14 Comments



File size: 5296 kB
Views: 6602
Downloads: 98
Download links:
Download plko 1 puro map   Mirror link



pLKO.1 puro (Plasmid #8453) ; Purpose. Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is.Purpose. (Empty Backbone) 3rd generation lentiviral plasmid for inducible expression of shRNA; puromycin selection. See manual for detailed protocols.Fast accurate construct design for all major molecular cloning techniques · Validate sequenced constructs using powerful alignment tools · Customize plasmid maps.Compared to siRNA and other vector-based systems, pLKO.1-puro provides solutions for long-term knockdown and.Gene/Insert name. Non-targeting shRNA · gRNA/shRNA sequence. CCTAAGGTTAAGTCGCCCTCG · Species. H. sapiens (human) · Promoter hU6 promoter.pLKO.1 puro (Plasmid #8453) - AddgeneTet-pLKO-puro (Plasmid #21915) - AddgenepLKO.1-puro-shNT (Plasmid #109012) - Addgene

Gene/Insert name. scramble shRNA · gRNA/shRNA sequence. Unspecified · Species. Other.Gene/Insert name. cGAS shRNA · gRNA/shRNA sequence. CAACTACGACTAAAGCCATTTCTCGAGAAATGGCTTTAGTCGTAGTTG · Species. H. sapiens (human) · Entrez Gene. CGAS ( a.k.a..pLKO.1-puro U6 sgRNA BfuAI stuffer. Lentiviral vector for expressing a single guide RNA (sgRNA) by inserting a target sequence between BfuAI sites.Sequence Information. Sequences (1) ; Vector backbone. pLKO.1-puro. (Search Vector Database) ; Vector type. CRISPR ; Selectable markers. Puromycin ; Bacterial.pLKO.1 puro GFP siRNA (Plasmid #12273) ; Depositing Lab. Bob Weinberg ; Publication. Orimo et al Cell. 2005 May 6. 121(3):335-48. ( How to cite ) ; Sequence.Vector Maps - Sigma-AldrichpLKO.1 puro Sequence and Map - SnapGenepLKO.1-puro-cGASsh4 (Plasmid #127646) - Addgene. juhD453gf

MISSION® pLKO.1-puro-CMV-TagRFP™ Positive Control Plasmid DNA Contains a gene encoding TagRFP; Synonyms: MISSION Control Vectors; find Sigma-Aldrich-SHC012.Zeocin® is an InvivoGen trademark. Depositor Comments. gRNA target sequence GGGCAAGTACGTCGATTCCA. How to cite this plasmid.MISSION® pLKO.1-puro Non-Mammalian shRNA Control Plasmid DNA Targets no known mammalian genes; Synonyms: MISSION Control Vectors; find Sigma-Aldrich-SHC002.MISSION® pLKO.1-puro eGFP shRNA Control Transduction Particles shRNA sequence targeting eGFP; Synonyms: MISSION TurboGFP Control Transduction Particles;.siRNA directed against beta-catenin: 5-GCTTGGAATGAGACTGCTGAT-3. Sequence from the website of the RNAi consortium at the Broad institute.Gene/Insert name. INPP5E · gRNA/shRNA sequence. Unspecified · Species. Canis Lupus · Entrez Gene. INPP5E ( a.k.a. PMPCA).pLKO.1-puro-UbC-TagFP635™ Vector Map U6 UbC TagFP635™ (Ψ) Psi pLKO.1-puro-UbC- TagFP635TM+shRNA 9171bp SIN/3 LTR RSV/5 LTR cPPT RRE.Plasmid pLKO.1-blast-SCRAMBLE from Dr. Keith Mostovs lab contains the. 3rd gen lentiviral shRNA expression vector containing scrambled shRNA sequence.MISSION pLKO.1-puro Non-Target shRNA Control Plasmid DNA; To see more application data, protocols, vector maps visit sigma.com/shrna.Each hairpin sequence was cloned into the lentiviral vector (pLKO.1) and sequence verified. Multiple constructs (4–5) were created per gene to ensure.MISSION pLKO.1-puro Luciferase shRNA Control Plasmid DNA; To see more application data, protocols, vector maps visit sigma.com/shrna.gRNA/shRNA sequence. ATCTCGCTTGGGCGAGAGTAAG ; Species. H. sapiens (human) ; Supplemental Documents. pLKO-Tet-On-shRNA-Control.gb ; Article Citing this Plasmid. 1.shRNA against p63 (all isoforms), cloned by Watnick, RS. shRNA sequence - 5-CCG GCC GTT TCG TCA GAA CAC ACA TCT CGA GAT GTG TGT TCT GAC GAA ACGPlasmid pLKO.1-puro U6 sgRNA SOX17 -177 from Dr. Scot Wolfes lab contains the insert Sox17 -177 sgRNA and is. gRNA target sequence GCTCCGGCTAGTTTTCCCGG.Gene/Insert name. PTEN · gRNA/shRNA sequence. Unspecified · Species. Canis Lupus · Entrez Gene. PTEN ( a.k.a. MMAC1).The 1.9kb stuffer can be released with AgeI and EcoRI and replaced with your shRNA sequence of choice. Also, see Addgenes pLKO.1 protocol.The pLKO.1 vector is a lentiviral (HIV)-based plasmid. Please consult with your institutions biosafety officer on specific requirements. Can the MISSION®.Gene/Insert name. shRPS6 · gRNA/shRNA sequence. CCGCCAGTATGTTGTAAGAAA · Species. H. sapiens (human) · Insert Size (bp). 58 · Entrez Gene. RPS6 ( a.k.a. S6).Gene/Insert name. IRF3 shRNA · gRNA/shRNA sequence. TACCCAGGAAGACATTCTGGATctgtgaagccacagatgggATCCAGAATGTCTTCCTGGGTA · Species. H. sapiens (human) · Entrez Gene.1-TRC cloning vector (www.addgene.org/10878), except the stuffer between AgeI and EcoRI is only about 24 bp (instead of 1.7kb) and the puro gene has been.Page 1. UbC. shRNA. U6. RRE. TurboGFP™. (Y) Psi. RSV/5 LTR. cPPT hPGK. pLKO.1-puro-UbC-. TurboGFP™M +shRNA. 9037bp. PUC ori. puroR. ampR. SIN/3 LTR..empty backbones for shRNA expression, such as pLKO.1 puro and. A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium A.2 Map of.siRNA directed against E-cadherin: 5-AAGATAGGAGTTCTCTGATGC-3. Sequence from the website of the RNAi consortium at the Broad institute.pLKO.1 Puro shRNA SNX9 KD1 (Plasmid #162014) ; gRNA/shRNA sequence. Unspecified ; Species. Canis Lupus ; Entrez Gene. SNX9 ; Cloning Information. Cloning method.Plasmid pLKO.1-puro U6 sgRNA Oct4A -12 from Dr. Scot Wolfes lab contains the insert Oct4A -12 sgRNA and is. gRNA target sequence GTGGGACTGGGGAGGGAGAG.Plasmid pLKO.1-puro U6 sgRNA SOX17 -126 from Dr. Scot Wolfes lab contains the insert Sox17 -126 sgRNA and is. gRNA target sequence GGAGGGGCAAGGGGCGGGCG.Gene/Insert name. NONO shRNA · gRNA/shRNA sequence. GCCAGAATTCTACCCTGGAAACTCGAGTTTCCAGGGTAGAATTCTGGC · Species. H. sapiens (human) · Entrez Gene. NONO ( a.k.a..Sequence Analyzer: pLKO.1 puro Sequencing Result. Download: GenBank File · SnapGene File; File Help. Map.Sequence Information. Sequences (2) ; Vector backbone. pLKO.1 puro. (Search Vector Database) ; Backbone manufacturer. Available at Addgene (#8453) ; Vector type.pLKO.1 mCherry (Plasmid #128073). Print. 255273_map. Enlarge; View all sequences. Purpose. puro exchanged to mCherry. Depositing Lab.gRNA/shRNA sequence. Unspecified ; Species. Canis Lupus ; Entrez Gene. PIK3C2G ; Cloning Information. Cloning method Ligation Independent Cloning ; Cloning method.shRNA sequence targeting tGFP. MISSIONand#174; pLKO.1-puro TurboGFPand#8482; shRNA Control Plasmid. All Photos(1). Synonym(s): MISSION Control Vectors.5 pLKO.1-puro Non-Mammalian. shRNA Control Plasmid DNA (SHC002), is a negative control containing a sequence that should not target.MISSION pLKO.1-puro eGFP shRNA Control Plasmid DNA; To see more application data, protocols, vector maps visit sigma.com/shrna.Plasmid pLKO.1 shSCR from Dr. Sheila Stewarts lab contains the insert shSCR and. Full plasmid sequence is not available for this item. pLKO.1 puro.Zeocin® is an InvivoGen trademark. Depositor Comments. gRNA target sequence GGGGCGCCAGTTGTGTCTCC. How to cite this plasmid.MISSION pLKO.1-puro-CMV-TurboGFP Positive Control Plasmid DNA; To see more application data, protocols, vector maps visit sigma.com/shrna.Features of the pLKO.1-puro vector allow for transient or stable transfection of the shRNA as well as.Sequence Information. Sequences (5) ; Vector backbone. pRRLSIN. (Search Vector Database) ; Vector type. Mammalian Expression, Lentiviral, RNAi ; Selectable markers.

Posts Comments

Write a Comment